Marcatori genetici nel plant breeding
UtilizzoUtilizzo
Identificazione clonaleIdentificazione clonale
Analisi dei parentaliAnalisi dei parentali
Struttura familiareStruttura familiare
Struttura di popolazioneStruttura di popolazione
Flusso genicoFlusso genico
FilogeografiaFilogeografia
IbridizzazioneIbridizzazione
FilogenesiFilogenesi
SC
AL
AS
CA
LA
Marcatori in biologia
Marcatori fenotipici = caratteri distinguibili a occhio nudo
P = E+G
Colore del fiore, forma del baccello, etc..
Karl Von Linne (1707-1778)
Sequenze di proteine o DNA facilmente distinguibili, la cui eredità può essere verificata e associata con tratti ereditati indipendentemente dall’ambiente :
a) Polimorfismi di proteineb) Polimorfismi di DNA
Molecular markers
MolecularMolecular markersmarkersP
o ter
e d i
ris
o lu z
ione
Pot
ere
d i r
iso l
uzio
ne
allozimi (elettroforesi di proteine)allozimi (elettroforesi di proteine)
DNA cloroplastico PCR-RFLPDNA cloroplastico PCR-RFLP
RAPDRAPD(random amplified polymorphic DNA)(random amplified polymorphic DNA)
AFLPAFLP(Amplified Fragment Length Polymorphism)(Amplified Fragment Length Polymorphism)
Multi-locus fingerprintsMulti-locus fingerprints
Microsatelliti (SSRs)Microsatelliti (SSRs)
SequenzeSequenze (SNPs)(SNPs)
Proteine di riserva del seme
Isozimi
Polimorfismi di proteine
Isozimi Isozimi
Starch gel of the isozyme malate dehydrogenase (MDH). The Starch gel of the isozyme malate dehydrogenase (MDH). The numbers indicate first the MDH locus, and next the allele present numbers indicate first the MDH locus, and next the allele present
(ie. 3-18 is locus 3 allele 18). Some bands are heterodimers (ie. 3-18 is locus 3 allele 18). Some bands are heterodimers (intralocus or interlocus).(intralocus or interlocus).
Isozimi Isozimi
dal cromosoma al DNA
Struttura del DNA
1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggagt 661 ctgaaatcac catctacctt tacttaggtt ctgagtgcca aacccaaggc accaggcatg 721 cgtccttgac tccggagcca tcaggcaggc tttcctcagc cttttgcagc caagtctttt 781 agcctattgg tctgagttca gtgtggcagt tggttaggaa agaaggtggt tcttcgacca 841 ctaacagttt ggatttttta ggatgctagt cctttaaaa ……….
Stretch of nitrogen fixation gene in soybean
DNA
Gene A Gene B
AACCTGAAAAGTTACCCTTTAAAGGCTTAAGGAAAAAGGGTTTAACCAAGGAATTCCATCGGGAATTCCG
MFG
1 ccacgcgtcc gtgaggactt gcaagcgccg cggatggtgg gctctgtggc tgggaacatg 61 ctgctgcgag ccgcttggag gcgggcgtcg ttggcggcta cctccttggc cctgggaagg 121 tcctcggtgc ccacccgggg actgcgcctg cgcgtgtaga tcatggcccc cattcgcctg 181 ttcactcaga ggcagaggca gtgctgcgac ctctctacat ggacgtacag gccaccactc 241 ctctggatcc cagagtgctt gatgccatgc tcccatacct tgtcaactac tatgggaacc 301 ctcattctcg gactcatgca tatggctggg agagcgaggc agccatggaa cgtgctcgcc 361 agcaagtagc atctctgatt ggagctgatc ctcgggagat cattttcact agtggagcta 421 ctgagtccaa caacatagca attaaggtag gaggagggat ggggatgttg tgtggccgac 481 agttgtgagg ggttgtggga agatggaagc cagaagcaaa aaagagggaa cctgacacta 541 tttctggctt cttgggttta gcgattagtg cccctctctc atttgaactc aactacccat 601 gtctccctag ttctttctct gcctttaaaa aaaaatgtgt ggaggacagc tttgtggag
MFG
molecular marker?
M1 M2
readily detectable sequence of DNA whose inheritance can be monitored and associated with the trait inheritance
Image from UV light table
Image from computer screen
Polymorphism-Parent 1 : one band-Parent 2 : a smaller band-Offspring 1 : heterozygote
= both bands-Offspring 2 : homozygote
parent 1
Polymorphism
Parent 1 : one band
-Parent 2 : no band
-Offspring 1 : homozygote parent 1
-Offspring 2 : ????
P 2P 1 O 2O 1
Gel configuration
Co-dominant marker
P 2
Gel configurationP 1 O 1 O 2
Dominant marker
Dominant Dominant versusversus Co-dominant Co-dominant
Dominant:Dominant:
No distinction between homo- and heterozygotes No distinction between homo- and heterozygotes possiblepossible
No allele frequencies availableNo allele frequencies available
AFLP, RAPDAFLP, RAPD
Co-dominant:Co-dominant:
homozygotes can be distinguished from homozygotes can be distinguished from heterozygotes; allele frequencies can be calculatedheterozygotes; allele frequencies can be calculated
microsatellites, SNP, RFLPsmicrosatellites, SNP, RFLPs
* Polymorphic
* Occurs throughout the genome
* Co-dominant inheritance
* Easy, fast and cheap to detect
* Reproducible
Desirable properties for a good molecular marker
* Selectivity neutral
* High resolution with large number of samples
Basis for DNA marker technology
•Restriction Endonucleases
•DNA-DNA hybridization
•Polymerase chain reaction (PCR)
•DNA sequencing
RFLP based markers
*Examine differences in size of specific DNA restriction fragments
*Usually performed on total cellular genome
*Require pure, high molecular weight DNA
Nameof theenzyme
Taq I MboI Alu I Dde I Rsa I Scrf I Msp I HaeIII
Ssp I
Numberofcuttingsites
639 623 341 309 286 239 214 196 137
Cuttingsites
TCGA GATC AG CT C TNAG GT AC CC NGG CC GG GGCC
AAT ATT
Note: N represent any base : A, T, C or G
Endonucleases and restriction sequences
AAATCGGGACCTAATGGGCC ATTTAGGGCAATTCCAAGGAYFG
Ind 1 Ind 2
RFLP techniques
3
6
2
61 2 43 5
4
5
1MFG
RFLP Polymorphisms interpretation
Advantages and disadvantages of RFLP
• Advantages– Reproducible– Co-dominant– Simple
• Disadvantages– Time consuming– Expensive– Use of
radioactive probes
DNA/DNA Hybridization
Denaturation
Elevated temperature
Known DNA sequence
Polymerase Chain Reaction
•Powerful technique for amplifying DNA•Amplified DNA are then
separated by gel electrophoresis
PCR based methods
1. Reactions conditions
*Target DNA ( or template)
*Reaction buffer containing the co-factor MgCl2*One or more primers
*Thermostable DNA polymerase
*Four nucleotides (dATP, dCTP, dGTP, dTTP)
2. Use of DNA polymerase
= an enzyme that can synthesize DNA at
elevated temperature
ex : Taq = enzyme purified from hot spring bacterium : Thermus
aquaticus3. Thermal cycle
*Denaturing step - one to several min at 94-96 º C
*Annealing step - one to several min at 50-65 º C
*Elongation step - one to several min at 72 º C
4. Repetition–typically 20 to 50 times average 35 times
AFLP MarkersAFLP Markers
Most complex of marker technologiesMost complex of marker technologies Involves cleavage of DNA with two Involves cleavage of DNA with two
different enzymesdifferent enzymes Involves ligation of specific linker Involves ligation of specific linker
pairs to the digested DNApairs to the digested DNA Subsets of the DNA are then Subsets of the DNA are then
amplified by PCRamplified by PCR
AFLP MarkersAFLP Markers
The PCR products are then separated The PCR products are then separated on acrylamide gelon acrylamide gel
128 linker combinations are readily 128 linker combinations are readily availableavailable
Therefore 128 subsets can be amplifiedTherefore 128 subsets can be amplified Patented technologyPatented technology
AFLP MarkersAFLP Markers
Technically demandingTechnically demanding Reliable and stableReliable and stable Moderate costModerate cost Need to use different kits adapted to Need to use different kits adapted to
the size of the genome being the size of the genome being analyzed.analyzed.
Like RAPD markers need to be Like RAPD markers need to be converted to quick and easy PCR converted to quick and easy PCR based markerbased marker
RAPD MarkersRAPD Markers
There are other problems with RAPD There are other problems with RAPD markers associated with reliabilitymarkers associated with reliability
Because small changes in any Because small changes in any variable can change the result, they variable can change the result, they are unstable as markersare unstable as markers
RAPD markers need to be converted RAPD markers need to be converted to stable PCR markers. to stable PCR markers.
How?How?
RAPD MarkersRAPD Markers
The polymorphic RAPD marker band The polymorphic RAPD marker band is isolated from the gelis isolated from the gel
It is used a template and re-PCRed It is used a template and re-PCRed The new PCR product is cloned and The new PCR product is cloned and
sequencedsequenced Once the sequence is determined, Once the sequence is determined,
new longer and specific primers can new longer and specific primers can be designedbe designed
RAPD
• Domimant markers• Reproducibility
problems
• Amplifies anonymous stretches of DNA using arbitrary primers
• Fast and easy method for detecting polymorphisms
RAPD Polymorphisms among landraces of sorghum
M
Sequences of 10-mer RAPD primers
Name Sequence
OP A08 5’ –GTGACGTAGG- 3’OP A15 5’ –TTCCGAACCC- 3’OP A 17 5’ –GACCGCTTGT- 3’OP A19 5’ –CAAACGTCGG- 3’OP D02 5’ –GGACCCAACC- 3’
RAPD gel configuration
Sequence
GCGCCGAGTTCTAGGGTTTCGGAATTTGAACCGTC
ATTGGGCGTCGGTGAAGAAGTCGCTTCCGTCGTTTGATTCCGGTCGTCAGAATCAGAATCAGAATCGATATGGTGGCAGTGGTGGTGGTGGTGGTGGTTTTGGTGGTGGTGAATCTAAGGCGGATGGAGTGGATAATTGGGCGGTTGGTAAGAAACCTCTTCCTGTTAG
ATTCTGGAATGGAACCAGATCGCTGGTCTAGAGGTTCTGCTGTGGAACCA…..
Repeat
GGT(5)
SSR repeats and primers
GAGGGCTGATGAGGTGGATA
ATCTTATGGCGGTTCTCGTG
AATCCGGACTAGCTTCTTCTTCTTCTTCTTTAGCGAATTAGGP1
AAGGTTATTTCTTCTTCTTCTTCTTCTTCTTCTTAGGCTAGGCGP2
P1 P2
SSR polymorphisms
Gel configuration
Linkage groups
M
SSR scoring for F 5:6 pop from the cross Anand x N97-3708-13
Ana
ndN
97
4. SNPs (Single Nucleotide Polymorphisms)
•Any two unrelated individuals differ by one base pair every 1,000 or so, referred to as SNPs.•Many SNPs have no effect on cell function and therefore can be used as molecular markers.
Hybridization using fluorescent dyesSNPs on a DNA strand
DNA sequencing
Sequencing gel
Sequencer
Sequencing graph
Single gene trait: seed shape Multigenic trait; ex: plant growth =Quantitative Trait Loci
Types of traits =types of markers
MFG MFG
USES OF MOLECULAR MARKER
Measure genetic diversityMeasure genetic diversity
Mapping Mapping TaggingTagging
Genetic DiversityGenetic Diversity
Define appropriate geographical scales for Define appropriate geographical scales for monitoring and management (epidemology)monitoring and management (epidemology)
Establish gene flow mechanismEstablish gene flow mechanism identify the origin of individual (mutation identify the origin of individual (mutation
detection)detection) Monitor the effect of management practicesMonitor the effect of management practices
manage small number of individual in ex situ manage small number of individual in ex situ collectioncollection
Establish of identity in cultivar and clones Establish of identity in cultivar and clones (fingerprint)(fingerprint)
paternity analysis and forensicpaternity analysis and forensic
Genetic DiversityGenetic Diversity
early selectionearly selectionof the good alleleof the good allele
seeds,plantlets
fingerprints
Gotcha!
MappingMapping
The determination of the position The determination of the position and relative distances of gene on and relative distances of gene on chromosome by means of their chromosome by means of their
linkage linkage
Genetic mapGenetic mapA linear arrangement of genes or genetic markers A linear arrangement of genes or genetic markers
obtained based on recombinationobtained based on recombination Physical mapPhysical map
A linear order of genes or DNA fragmentsA linear order of genes or DNA fragments
Physical MappingPhysical Mapping
It contains ordered overlapping It contains ordered overlapping cloned DNA fragmentcloned DNA fragment
The cloned DNA fragments are The cloned DNA fragments are usually obtained using restriction usually obtained using restriction
enzyme digestion enzyme digestion
QTL MappingQTL Mapping
A set of procedures for detecting A set of procedures for detecting genes controlling quantitative traits genes controlling quantitative traits (QTL) and estimating their genetics (QTL) and estimating their genetics
effects and locationeffects and location
To assist selectionTo assist selection
Marker Assisted SelectionMarker Assisted Selection
Breeding for specific traits in plants Breeding for specific traits in plants and animals is expensive and time and animals is expensive and time consumingconsuming
The progeny often need to reach The progeny often need to reach maturity before a determination of maturity before a determination of the success of the cross can be madethe success of the cross can be made
The greater the complexity of the The greater the complexity of the trait, the more time and effort trait, the more time and effort needed to achieve a desirable result.needed to achieve a desirable result.
MASMAS
The goal to MAS is to reduce the time The goal to MAS is to reduce the time needed to determine if the progeny needed to determine if the progeny have traithave trait
The second goal is to reduce costs The second goal is to reduce costs associated with screening for traitsassociated with screening for traits
If you can detect the distinguishing If you can detect the distinguishing trait at the DNA level you can trait at the DNA level you can identify positive selection very early. identify positive selection very early.
Developing a MarkerDeveloping a Marker
Best marker is DNA sequence Best marker is DNA sequence responsible for phenotype i.e. gene responsible for phenotype i.e. gene
If you know the gene responsible and If you know the gene responsible and has been isolated, compare has been isolated, compare sequence of wild-type and mutant sequence of wild-type and mutant DNADNA
Develop specific primers to gene that Develop specific primers to gene that will distinguish the two forms will distinguish the two forms
Developing a MarkerDeveloping a Marker
If gene is unknown, screen contrasting If gene is unknown, screen contrasting populations populations
Use populations rather than individualsUse populations rather than individuals Need to “blend” genetic differences Need to “blend” genetic differences
between individual other than trait of between individual other than trait of interestinterest
Developing MarkersDeveloping Markers
Cross individual differing in trait you Cross individual differing in trait you wish to develop a markerwish to develop a marker
Collect progeny and self or polycross Collect progeny and self or polycross the progenythe progeny
Collect and select the F2 generation Collect and select the F2 generation for the trait you are interested infor the trait you are interested in
Select 5 - 10 individuals in the F2 Select 5 - 10 individuals in the F2 showing each traitshowing each trait
Developing MarkersDeveloping Markers
Extract DNA from selected F2sExtract DNA from selected F2s Pool equal amounts of DNA from each Pool equal amounts of DNA from each
individual into two samples - one for individual into two samples - one for each traiteach trait
Screen pooled or “bulked” DNA with Screen pooled or “bulked” DNA with what method of marker method you what method of marker method you wish to usewish to use
Method is called “Bulked Segregant Method is called “Bulked Segregant Analysis”Analysis”
Marker DevelopmentMarker Development
Other methods to develop population Other methods to develop population for markers exist but are more for markers exist but are more expensive and slower to developexpensive and slower to develop
Near Isogenic Lines, Recombinant Near Isogenic Lines, Recombinant Inbreeds, Single Seed Decent Inbreeds, Single Seed Decent
What is the advantage to markers in What is the advantage to markers in breeding?breeding?
Reducing Costs via MASReducing Costs via MAS
Example disease resistance Example disease resistance • 10000 plants 10000 plants
Greenhouse space or field plots Greenhouse space or field plots • $5000 - $10000 $5000 - $10000
Time 4 months (salary) Time 4 months (salary) • $10 - $15000 $10 - $15000 • total cost = $15 - $25,000total cost = $15 - $25,000
Reducing Costs via MASReducing Costs via MAS
PCR-based testing @ $5 sample PCR-based testing @ $5 sample $50,000 - costs more? $50,000 - costs more? Analysis of trait not easily phenotypedAnalysis of trait not easily phenotyped E.g: Cadmium in Durum wheatE.g: Cadmium in Durum wheat 10000 plants need to reach maturity10000 plants need to reach maturity Cadmium accumulates in seedCadmium accumulates in seed
Reducing costs via MASReducing costs via MAS
$15 - 25 growing costs + analysis$15 - 25 growing costs + analysis Atomic Absorption @ $15 per sampleAtomic Absorption @ $15 per sample $150,000 + growing costs$150,000 + growing costs PCR analysis still $50000PCR analysis still $50000 Savings in time and money increase Savings in time and money increase
as more traits are analyzed as more traits are analyzed Many biochemical tests cost >$50 Many biochemical tests cost >$50
samplesample
Marker Assisted BreedingMarker Assisted Breeding
MAS allows for gene pyramiding - MAS allows for gene pyramiding - incorporation of multiple genes for a incorporation of multiple genes for a traittrait
Prevents development of biological Prevents development of biological resistance to a generesistance to a gene
Reduces space requirements - Reduces space requirements - dispose of unwanted plants and dispose of unwanted plants and animal early animal early
Trait2.58.47.12.54.52.3
P.1P.2I.1I.2I.3I.4
M. 1133221
M. 2131131
M. 3131123
QTL study
Statistical programs used in molecular marker studies* SAS* ANOVA* Mapmaker* Cartographer
Types of population used for molecular markers studies: F2, RILs, Backcrosses (MILs), DH.
QTL MappingQTL Mapping