+ All Categories
Transcript
Page 1: Lago News September 2009

1

#6

LAGO NEWS SETTEMBRE 2009

Brochure settembre 01.indd 1 7-08-2009 9:58:41

Page 2: Lago News September 2009

L’Appartamento è una nuova visione sul futuro

L’Appartamento è un progetto Lago, nato dalla consapevolezza

che il design non deve guardare soltanto al singolo prodotto,

ma al miglioramento della vita e del lavoro delle persone.

Con questa idea in testa, abbiamo individuato un modo innovativo

di sostenerla economicamente.

L’Appartamento è una rete di case nelle quali le persone più

interessanti si incontrano e pensano a come riprogettare la vita

e il territorio. E’ uno spazio incredibilmente bello, progettato per

accogliere, lavorare, rilassare e far nascere le idee che disegneranno

il futuro.

Gli appartamenti sono nelle grandi città ma non solo: sono dovunque

ci siano fermento, energia e persone che hanno idee per cambiare

il mondo.

Tutti possono candidarsi per aprire un appartamento, viverci, lavorarci,

e farlo diventare un punto di riferimento in città.

L’Appartamento è un nuovo modello economico

Chi sa rendere speciale un Appartamento è il padrone di casa - il tenant

- che per un periodo decide di vivere in un Appartamento Lago.

Il tenant ha il compito di organizzare eventi, conoscere chi fa

innovazione nella sua città e sviluppare occasioni di networking, far

conoscere a più persone possibile il luogo dove vive. Per questo il

tenant che cerchiamo è una persona speciale, capace di coinvolgere,

promuovere, progettare, cogliere la sfi da.

Il tenant è Appassionato di design e sa tutto dei mobili Lago, per

questo ne è l’ambasciatore in città. Aprendo la propria casa aiuterà

altre persone nella progettazione e nella scelta di acquistare dei mobili

Lago, per poi indirizzarle ad un negozio di riferimento. In questa sua

attività il tenant è supportato da Lago che fornisce l’arredamento della

casa ad un prezzo agevolato, la formazione e gli strumenti necessari.

Forse vivere in un Appartamento non potrà diventare il tuo lavoro

principale, ma sarà un’ottimo lavoro integrativo.

Invia la tua candidatura su appartamento.Lago.it

Brochure settembre 02.indd 2 7-08-2009 10:37:56

Page 3: Lago News September 2009

Appartamento is a new vision over the future.

Appartamento is a Lago project, conceived through the awareness

that design in not only about the individual product, but also about

improving people’ lives and work environments.

With this in mind, we thought of an innovative way to support this

idea fi nancially.

Appartamento is a fl at where the most interesting people meet

and discuss about how to re-design, plan life and environments.

It’s a an extremely confortable and pleasant space where to welcome

people, work, relax and come up with ideas that will tailor the future.

These fl ats are located in big cities, but not only: they are everywhere

there is energy and people who have ideas which will re-defi ne the

world.

Everybody can apply to open up a Lago fl at (Appartamento), to live

and work in it, to make it become a melting pot for the city.

Appartamento is a new economic template.

The person who makes an appartamento special is either a landlord

or a tenant, who choses to live in a Lago fl at for a while. This person

has to organise events, to get in contact with people who are involved

with innovation within his/her city, to develop networking opportunities

and to introduce his/her fl at to as many people as possible. That’s why

we are looking for special people capable of attracting, promoting,

designing and taking the challenge.

The landlords/tenants is passionate about design and knows Lago’s

furniture well. He/she is the Lago’s ambassador in the city. By opening

the doors of his/her own fl at, he/she will help other people to design

their houses’ interior with Lago’s furniture and address them to the

nearest dealer. Lago supports the landlord/tenant by providing the fl at

furnishing at a special price, training and all the necessary tools.

Maybe living in an Appartamento may not become your main job,

but it could be a cool second job.

Please send your appllication to appartamento.Lago.it

APPARTAMENTOa place for re-designing life

Brochure settembre 03.indd 3 7-08-2009 10:44:17

Page 4: Lago News September 2009

Cucina/kitchen 36e8, tavolo/table Air, altalena/swing Softswing

Brochure settembre 04.indd 4 7-08-2009 10:19:51

Page 5: Lago News September 2009

5

Brochure settembre 05.indd 5 7-08-2009 10:36:39

Page 6: Lago News September 2009

Libreria/bookcase L/\goLII\IE/\, poltroncina/armchair Huggy

Brochure settembre 06.indd 6 7-08-2009 10:27:51

Page 7: Lago News September 2009

7

Brochure settembre 07.indd 7 7-08-2009 10:47:32

Page 8: Lago News September 2009

Scrivanie/desks Air, libreria/bookcase Air, contenitori/storage units 36e8

Brochure settembre 08.indd 8 7-08-2009 10:32:09

Page 9: Lago News September 2009

9

Brochure settembre 09.indd 9 7-08-2009 10:23:05

Page 10: Lago News September 2009

Letto/bed Air, comodino/bedside table 36e8, armadi/wardrobes N.O.W.

Brochure settembre 10.indd 10 7-08-2009 10:28:42

Page 11: Lago News September 2009

11

Brochure settembre 11.indd 11 7-08-2009 10:20:38

Page 12: Lago News September 2009

Letto/bed Fluttua, libreria/bookcase 30MM, cassettiera/drawers unit Morgana, poltroncina/armchair Huggy

Brochure settembre 12.indd 12 7-08-2009 10:45:16

Page 13: Lago News September 2009

Brochure settembre 13.indd 13 7-08-2009 10:27:20

Page 14: Lago News September 2009

Libreria/bookcase L/\goLII\IE/\

Brochure settembre 14.indd 14 7-08-2009 10:43:32

Page 15: Lago News September 2009

15

Bagno/bathroom 36e8

Brochure settembre 15.indd 15 7-08-2009 10:42:57

Page 16: Lago News September 2009

36e8 Cucina

L. 478,5

H. 204,1

P. 27/40,6

61/67

Tavolo Air

L. 250

H. 76

P. 100

L/\goLII\IE/\

L. 392

H. 214,8

P. 24,8

36e8

L. 294,4

H. 133,8

P. 27/40,6

Softswing

L. 56,8

H. 6

P. 28,8

L/\goLII\IE/\

L. 85,6

H. 204,4

P. 24,8

36e8

L. 220,8

H. 93,7

P. 40,6

Softbench

L. 129,5

H. 43,9

P. 40,2

Settimanale

Morgana

L. 60

H. 138

P. 45

36e8+30MM

L. 282

H. 202,4

P. 24,8/27

Tavolo Air

L. 160

H. 76

P. 85

Frigo Freestading

L. 61

H. 155,6

P. 61

Huggy

L. 130

H. 78

P. 80

36e8+30MM

L. 478,4

H. 239,2

P. 24,8/27/40,6

Armadio N.O.W.

L. 116,5

H. 290

P. 61

Letto Air

160x200

36e8-Comò

L. 147,2

H. 18,4 (55,2 da terra)

P. 40,6

Libreria Air

L. 184,0

H.155,7

P.40,6

Comodino Morgana

L. 60 H.

H. 66,1 (con ruote)

P. 45

N.O.W.

Colonna

cucina

L. 315,3

H. 227,0

P. 67,0

Letto Fluttua

160x200

Georgi

Manassiev

Multifunctional

nails

Appendiabiti

Georgi

Manassiev

Plate

Piatto

Harry Thaler

One Barrel light

Lampadario

Hwang Kim

The Cocoon -

Portable urban

shelter for a home-

less'

Rifugio urbano

portatile per

senzatetto

Ilgu Cha

Trace of

Time

Orologio

Krystian

Kowalski

Giraffe

Sgabello

Nicola Zocca

Harry Thaler

Compressedairbike

Bici ad aria

compressa

Seongyong

Lee

Color space

Libreria

Yuya

Kurata

Edison’s

Exuviae

Candela

Abitanti dell’Appartamento

16 17 18 19 20 2112 13 14 15

1

2

4

5

6

7

8

9

10

11

3

2122

23

11

12

14

15

1718

19

20

Brochure settembre 16.indd 16 7-08-2009 10:27:40

Page 17: Lago News September 2009

17

36e8 Totem

L. 73,6

H. 220,8

P. 27

36e8 Bagno

L. 257,6

H. 177

P. 27/52

Pontaccio

L. 100

H. 38

P. 18+24

Armadio

N.O.W.

L. 185,5

H. 265

P. 61

L/\goLII\IE/\

L. 235,8

H. 222,5

P. 24,8

36e8+30MM

Comò

L. 245,2

H. 184

P. 24,8/40,6

30 MM

L. 42,8

H. 184

P. 24,8

Letto Fluttua

100x200

Letto

Justmat

100x200

Armadio

N.O.W.

L. 185,5

H. 265

P. 61

Seongyong Lee

ONIV

Vaso portacandele

Seongyong

Lee

Shade Light

Lampada

ShiKai

The Door

Lampada

porta

Valentin

Vodev

Radio

Valerie

Radio

Yiting Cheng

Sean Yu

Wall clock

Orologio da

muro

Yiting Cheng

Sean Yu

Neon light

trap

Neon

Yuya Kurata

Lion Door

Knocker +

Hook

Battiporta

appendiabiti

Valentin

Vodev

Soft Flexible

Lamp

Lampada

Tien Sheng

Lighting Dryer

Lampada

asciugatrice

Nicola

Zocca

Bill light

Lampada

22 23 24 25 26 27 28 29 30 31

16

8

9

24

25

29

30

31

2

3

4

5

7

10

13

1626

27

28

Brochure settembre 17.indd 17 7-08-2009 10:44:37

Page 18: Lago News September 2009

LAGO HOMESMelting Architecture with Design. Experimental Projects by Fram_menti Architecture Studio

Una storia, una vita, un modo di usare lo spazio

che ci sta attorno… ognuno di noi vive lo spazio

dell’abitare in modo unico, irripetibile. I prodotti

LAGO contengono la possibilità di dare un’immagine

a questa unicità. Da qui l’idea di LAGO HOMES,

per dare una forma unica alla propria casa,

sperimentando soluzioni che fondano architettura

e design. Ogni casa diventa una storia, i prodotti

diventano i mattoni con cui costruire questa storia,

con cui fare architettura. Il progetto LAGO HOMES

segna l’inizio di una sperimentazione e nel contempo

riassume lo spirito LAGO, gli ingredienti della nostra

passione, del nostro lavoro attorno a ciò da cui non

possiamo prescindere: HOME.

One story, one life, one way to use the space

surrounding us: each of us live his/her living space in

a unique and unrepeatable way. The LAGO

products contain the possibility to offer a picture of

such uniqueness. Hence the idea of LAGO HOMES,

in order to give an outstanding shape to people’s

home, experimenting solutions which melt

architecture with design. Each home becomes a

story, and the products become the bricks

with which people build their story, with which they

can make architecture. The LAGO HOMES project

marks the beginning of a testing process and, at

the same time, summarizes the LAGO spirit, the

ingredients of our passion, of our work on this and

from which we cannot do without: HOME.

1

2

hOMe

Prodotti utilizzati: Air, Now.

Product used: Air, Now.

Having Only More Earth

Prodotti utilizzati: 36e8 cucina,

36e8 e Now.

Product used: 36e8 cucina,

36e8 and Now.

1

2

Brochure settembre 18.indd 18 7-08-2009 10:20:13

Page 19: Lago News September 2009

19

1

2

Brochure settembre 19.indd 19 7-08-2009 10:33:58

Page 20: Lago News September 2009

36e8

Basato su un modulo da 36,8 cm x 36,8 cm questo

sistema dona allo spazio forma e sostanza creando

volumi di differente lunghezza da accostare gli

uni agli altri con innumerevoli opportunità di

contenimento.

Con 36e8 tutti possono diventare i designer

del proprio spazio. Come? Accostando i moduli

36e8 per disegnare la composizione che soddisfa

maggiormente gusto e necessità.

Based on a 36.8 cm x 36.8 cm module, this system

gives space a form and substance by creating

volumes of different lengths that can be matched

together in endless combinations.

36e8 means that everyone can design their own

home spaces. How? 36e8 modules can be mixed

and matched to design compositions meeting every

taste and requirement.

1

36e8: comp. 150

Contenitori in vetro lucido

kaki, verde acido e in vetro

opaco bianco.

Kaki, verde acido polished

glass and bianco opaque glass

storage units.

L 404,8 H 222,5 P 27/40,6/56

Prezzo a partire da/Price from

€ 5.076

1 36e8: comp. 164

Contenitori in vetro lucido

grafi te, aragosta, mandorla,

salvia, sole, verde acido,

bosco e fumo.

Grafi te, aragosta, mandorla,

salvia, sole, verde acido,

bosco and fumo polished

glass storage units.

L 368 H 202,4 P 27/40,6/56

Prezzo a partire da/Price from

€ 4.140

2

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Brochure settembre 20.indd 20 7-08-2009 10:44:47

Page 21: Lago News September 2009

21

2

Brochure settembre 21.indd 21 7-08-2009 10:28:10

Page 22: Lago News September 2009

36e8: comp. 171

Contenitori in vetro lucido

bianco, amaranto e in vetro

opaco nero.

Bianco, amaranto polished

glass and nero opaque glass

storage units.

L 368 H 211,6 P 27/40,6/56

Prezzo a partire da/Price from

€ 4.945

36e8: comp. 173

Contenitori in vetro lucido

bianco, paglia, spago e sole.

Bianco, paglia, spago and sole

polished glass storage units.

L. 515,2 - H. 167,3 - P. 27/56

Prezzo a partire da/Price from

€ 6.286

36e8: comp. 152

Contenitori in vetro lucido

bianco.

Bianco polished glass storage

units.

L 368 H 220,8 P 40,6

Prezzo a partire da/Price from

€ 4.424

1

2

3

1

2

3

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Brochure settembre 22.indd 22 7-08-2009 10:24:49

Page 23: Lago News September 2009

23

30MM

Non importa dove importa come

30MM è l’esile spessore dei fi anchi di questo

nuovo sistema di librerie LAGO che grazie ad

uno speciale attacco a muro può essere fi ssato

a parete e anche sospeso. Questa versatilità

consente di creare composizioni fantasiose come

alberi, nuvole, forme astratte, semplici o eleganti.

Il sistema 30MM è disponibile anche con fi anchi e

ripiani di spessore 50mm e 80mm.

30MM - LAGO’s new slim line bookshelf system

that, thanks to a special wall-mounting system,

can be secured to or suspended from walls.

Such versatility can be exploited to create

imaginative compositions such as trees, clouds,

abstract, simple or elegant shapes.

The 30MM system is also available with sides and

tops in 50mm and 80mm thicknesses.

1

2

30MM: comp. 303

Laccato bianco, sole, paglia,

avio. Schienali vetro lucido

fumo, sole, paglia, avio.

Lacquered bianco, sole,

paglia, avio. Polished glass

back fumo, sole, paglia,avio.

L. 386 - H. 266,8 - P. 24,8

Prezzo a partire da/Price from

€ 2.704

30MM: comp. 305

Laccato bianco.

Schienali vetro lucido cocco,

mandorla, spago, panna.

Lacquered bianco.

Polished glass back cocco,

mandorla, spago, panna.

L. 386 - H. 202,4 - P. 24,8

Prezzo a partire da/Price from

€ 2.987

1

2

Brochure settembre 23.indd 23 7-08-2009 10:30:14

Page 24: Lago News September 2009

L/\goLII\IE/\

1

The L/\goLII\IE/\ system has a slim and simple

design, conceived to offer maximum freedom when

designing wall compositions. Its what is left after

reducing a common grid bookshelf.

The essence of L/\goLII\IE/\ is a practical, minimalistic

solution to storing books, audio visual and

accessories. Unique shapes can be created to tell a

personal story.

The L/\goLII\IE/\ systems simplicity in it basic

materials brings aesthetic value and combines

innovative ideas which are price accessible.

From now on, everybody will be able to express

themselves through lines ;-)

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Il sistema L/\goLII\IE/\ è un segno grafi co snello e

leggero, progettato per offrire ad ognuno la massima

libertà espressiva a parete, è ciò che è rimasto

riducendo al minimo la classica libreria a griglia.

E’ l’essenziale in termini di utilità pratiche ed

emozionali, il necessario per riporre libri, televisore,

oggetti, è un modo originale per raccontare una

storia con un gesto.

Il sitema L/\goLII\IE/\ trasforma la riduzione di

materiale in valore estetico, riuscendo a far diventare

una libreria innovativa leggera anche nei costi.

Da oggi qualsiasi persona potrà disegnarsi a grandi

linee ;-)

Brochure settembre 24.indd 24 7-08-2009 10:43:58

Page 25: Lago News September 2009

25

L/\goLII\IE/\: comp. 312

Laccato bianco.

Lacquered bianco.

L. 361,6 - H. 190,4 - P. 24,8

Prezzo a partire da/Price from

€ 2.617

L/\goLII\IE/\: comp. 324

Laccato nero, fumo, grafi te,

mandorla. Frontali ante vetro

lucido nero, fumo, grafi te,

mandorla.

Lacquered nero, fumo, grafi te,

mandorla. Polished glass door

fronts nero, fumo, grafi te,

mandorla.

L. 337,2 - H. 211,6 -

P. 24,8/27/40,6/56

Prezzo a partire da/Price from

€ 3.222

L/\goLII\IE/\: comp. 322

Laccato rosso, lilla, kaki, verde

acido, amaranto, avio, prato,

salvia, sole.

Lacquered rosso, lilla, kaki,

verde acido, amaranto, avio,

prato, salvia, sole.

L. 248,2 - H. 211,6 - P. 24,8

Prezzo a partire da/Price from

€ 1.765

L/\goLII\IE/\: comp. 329

Laccato bianco, paglia, spago,

avio, grafi te. Frontali ante

vetro lucido spago, avio,

grafi te, paglia.

Lacquered bianco, paglia,

spago, avio, grafi te. Polished

glass door fronts verde acido,

kaki, sole, lilla, paglia.

L. 343,2 - H. 184 -

P. 24,8/27/40,6/56

Prezzo a partire da/Price from

€ 3.099

1

2

3

4

4

2

3

Brochure settembre 25.indd 25 7-08-2009 10:46:37

Page 26: Lago News September 2009

L/\goLII\IE/\: comp. 319

Laccato salvia, verde acido,

prato, bosco, castagno.

Lacquered verde acido, prato,

bosco, castagno.

L. 378,1 - H. 244,3 - P. 24,8

Prezzo a partire da/Price from

€ 2.838

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Brochure settembre 26.indd 26 7-08-2009 10:23:55

Page 27: Lago News September 2009

Pooinntt SSpppppppppaaaaaaaaaaaaccccccccccccccccccceeeeeeeeeeeeeeeeeeeeeeeeeee SSSSSSSSSttttttttooooooooooooooooooooorrrrrrrrrrrrrrrrrrrrrrrrrrrrreeeeeeeeeeeee

PoP ininininininnnnnnt,ttttttttttt PPPPPPPPPPPPPPPPPPPoioioioioioioioioooiooiooioioi ttntntntntttntnttttntntntntttntnt XXXXXXXXXXXXX XXLLLLL,L,LLL,L,L,LL,,L,, SSS SSSSSSSSSSSSSSpapapapapapapapaapppppppp cecececececececececececececee, Space e XLXXLXLXLXLXLXLXLLLLXL, , , , StStStSSSS orororrre…e…e…ee…e…e

ququessssssstitititittitit s ssonono o ooo iiiii i i nononononononoonoststststttttststttttttttrriiiiririririirirrr ppara tnerr. .. ... QQQQQuQuQuQQQuuQ esesesese titititiitti

sonon i negge ozozzi i chchche hahannno o o innininininninnnsisisisiemememme e e eee a a a nonononnnnoiiii

abababa bbbbbrbbbrrbrraaaaacaccacaca ciciciiatataattatoo o o unununun pp p p pprororoorooogegegeggegegegegggggg ttttttttttto ooooo dddiddii rrr iinnonovvavv mentntnn o oabbracciatoo un progettttttttttttttttt ooooo didid rrrinininnononoovavavavamememementntntntn oooooo

prprprprpprprpprprpprprprpp opopopoooopopopopopopoppoopppoo ooooooonononononoonooonnooo enenenenenenenenndododododododoodo u u u u uuuuuunnnnnnnnnn n nnnn nn n nnnnnnnununununununnnnunnnuovovovovovovovovo ooooooo oo o cococococococococoocoocococococooncncncncnccncnccccncn eetetettoto d ddddddi casasass

LAAAAAALALALAALAALALALAALALALALAALLAALALALALLLALAAALLAALAAAAGOGOGOGOGOGOGOGGOOGOOGOOGOOGOGOOGGGOOOG . .. . NoNoNoNoNoNoNoNoNNoNNooNoNNoNoooNoNoNoN nnn n nnn nnn sosososososososololololololololooooo dddddd d ddd d dddddddeieieieieieieieieieieeie ff f fff ffororororrorororoorrmmammmmmmamaammammmmmmmaaaam ttttt t ttttttt esespopopopopop sitiivivivivi

dddoddododooooddoooooodovevevevevevvvevevevevvevveevvvv p pp pppppp pp potototototototototottototto ereeeereerererererererererereerererr t tttttttt tttttttrororororororoorrrorooovavavavavavavvavavarerererereree l l l l lle e e e e eeee nonnonoonononnnossstsstststststttttssttssttttrererer ppprororrorr poststtte e mammaaa

uuuununununnnnuuunna aaaa aa a aaaaa rererreeeereeererretetetetetetetettetee d d d d dddddddi ii i iii pepepepepepeppersrsrsrsrsrsrrsononononononnnnnnonne eeeeeeeeeeeeeeeeeeeeeeeeee ccchcchchcchchhchcccccccccchhcchche ee eee eee ppopopopoppp rtrtrtrtaananaa o i nonnonoststttriririririi

vavavavavaaaavvaavv lolololooooooooolooooririririiririiiirrr a aa a aaaallllllllllll’i’i’’i’i’iintntntntnntntntererererereere nonononononoooo d d ddddddddeleeleleleleleleleleleeeleleeeeeeeele leeleeleleeleeeleleleleeleeleleeelelleelelle v v v vvvvvvvvvvvvvvvvvvvoosososoooo trtrtrtre e eee casesee, ,, cocoooonnnn

prprprpprrrpprproofoooofofofooofofffofeseeeeessssseeeeeeeessisisisisisisiononononoonoonnonnalalalallalititittitttà àà à à à ààààà ee e e e eee cococococococooocoocooooompmpmpmmmpmpmpmpppmpmppppmppmpmpppppmmppppmpppppetetetettenenene zazzz .

DaDDDDaaaaaDaDaDaa llll lloororooorrorooooroo o oo o o oo popopopopopopopopoopoopopooopopop trtrtrtrtrtttrttrtrtrttrtrrrrtrttrtraiaiaiaiaiaiaiaaaiaiaiaiaaaai t t tttt ttrororororororoorovavavavavavaaavaarererererererereerereereeeeeeereeereeee nn n nnnnnnuouououou vevvvv ideeeee eee e e spspspss untii

prpprrpprrrp oogogogogogoggogoooogeeeeteteteteteteteete tutututututututuualalalalalalaliiiiiiii i crcrcrcrcrccrcrrrcrcrcrccrcrc eeaeaeeaeaeaeeaeaeaeaeeaeaeaae tetetetetetteteeteteteeeteteete a a a aaaaaaaappppppppppppppppppppppppppppppppppppppppppppppppp osooososoooo tatatatatat per t tttttttttttte eeee eeeeeee eeee eeeee eeeeeeeeeeeeeeeeeeeeeeeeee eee ee e pepeppepppepepeppeppepepeppppppepepeppppeppepepepepepepeepeeepppppppppp rrrrrrrrrrrr r rrr llalaalallalalalaa

tututuuuuuuaaaaaa aaaaaa cacacacacacacaccaaaaacac sasasasasasasassas ...

PePeeeeeeePPeer rrr rrrrrrrr vivivivivivivivivvivivv susususususuusususualalalalalalala izizizizizzizzizii zazazazazazazazazzazz rerererererereeere i i iiiiiiii n n nn n nnn negegegegegegeggggggegggggeggggozozozozozozozozozozozozziiiiiiii iiiii i ii pipippipippippipipipipppppppppp ù ù ù ùùùù viviviviviviviviviviiviviviivvvivvviivvivvivvvvvvviv cicccciccccccccccccccccc nnnnnnnininininninnninnnn aa vvvvvvvooioiiioiioiooiooooooooo

clclllc iciciciciccccicccccccacacacaacacaaaacacaacateteteteteteteeee s s sssssu u u u uuu uu wwwwwwwwwwwwwwwwww w.w.w.w.w.ww.w.LaLaLaLaLaLaLaaLagogoogogogogoo.i..iii.ii.iiii.itttt ttt ttttt ---- ---- neneneneneneneeeeeegggggggogogogogogogogogoggggogoggggggggggg ziziiiiiiiziziii

PoPoPoPoPoPoPPoPPPoPPPoPoPoPPoPoPoPPPoPoPoPooPooP innnnnii t,,,,, P P P PPPPoioioioioioiooio ntntntntntntntntn XXX XXXX XXXLLLLL,LLL, SSSpapaaacececee, , , , ,, SpSpSSpSSSpSS acacacee e ee eeee XLXLLXLLLLLLLLL, , StStStttttttSttororore.e.e

ThThhhhThesesesseseesese ee ararrre e e ouououououoouo r rrrrrrr papapapapaappap rtrtrtrtrtttneneneenersrsrssrs. . ThThTTTTTT ese eee e ee aaararaare e e thhhtheeeee

shshshhhhshshshshshhhshopoopopopopooops s s s whwhwhwhwhwhwhwho o o ooooo hahahahahahaavevevevevevvvv e e eeeembmbmbmbmbm rararararaceceeeeed,d, tttttogoogogogggeteteeteee heheherrrrrrrrrrrrrr

wwiiiiithththhtht uuus,s,ss,s, a a aaaa r rr rrrenenenenennovovovovovovvatatatatatatioioioioioon n nnn pprpppp ojojoooojoo ececect,,,t,t, b by yyy y

prrrrrrropopoopopopososososssinininininnnng g g g g g a a aa aaa nenenenenenew w w wwww cococococoncncncncn epeepppeppeppt ttt ofoof tthehe L LLaggggoooo

hoooohhohooomememeemm . . . NoNoNoNoNoNoot t tttttt onononononono lylylylyyyly e e eee exhxhxhxhxhibibibibibitititititiitiooioiooooioon nnnnn fof rmrmmataaattatatttts ss whwhwhwhwwhwhwhwhwhwwhwwwhwhw ererereree

itit iis ssss popopoosssssssssssibibibibbibbblllellllee ttto o fiffiinddndn oourur p ppppproopopopp sasasaasasasals, bubububub t ttt

alalssssososos aaaaaa nnnnnettetetetetetete wowowowowowwwooworkrkrkrkkrkrkrkrkk o ooo ooooof f ff fffff pepepeppepepeopopopopleeleeeelel w wwhohoohoh b b bbbrrrrirrr ng

ouuuuuuuuur r rrr vaaalululuueseseses i i iiinsnsnsnssnsn ididididide e e e ee yoyoyoyoyooururururur h h h h hhomooooomoo esesesse , , wwwiwwww th

prprrrrrrrrrofoofofoofoo esessssisisisisiss onononononalalalalal sisisisissm m m mmmm ananananand d d ddd exexexexexeexpepeeeeertissisee.e.eee. T TTTTThhehhhh reeeee y yyouououu

wiiiiw llllllll bbbe e e e ababababbablelelelele t t ttt to o o o o o fififififif ndndndndndndn n n nnnewewewewewewe iiiiiiiiidedddded asassasasas a aaanndnnn clullul eseses

onnnnnnnnnnon hhhhowowowowww t t tttto o oooo plplplplplplp anananananan a aa a aa c c cccccususususuustototototototom-mm-mm-mm mamaaaamadedededede hhhommme e fofoffor rrrr

yoyoooyooooooyoou.uu.u.uu TTTTTo o sesesee ee ththt e ee clcclc ossossesesesee t ttt shsshshshshhsss opopopoppps ss ss s ss ccclcc icck oononnnn

wwwwwwwwwwwwwwwww.w.wwww LaLaLaLaLaLaLaLagogogogogogogogo.i.i.iiiiiitt tt t tt - - - shshshshshhshshhshopopopopoppoopssssssss

Opening soon: Lago Store Bilbao, Valencia, Lione, Leeds, Amiens, Colonia

Brochure settembre 27.indd 27 7-08-2009 10:47:55

Page 28: Lago News September 2009

36e8 CUCINADesign Daniele Lago

Nasce la cucina non cucina 36e8 cucina è un progetto che alleggerisce la

percezione di ingombro e pienezza delle cucine viste

sino ad oggi; l’approccio progettuale è totalmente

rivoluzionario: nasce la cucina-non-cucina che si

sgancia dai rigidi schemi compositivi e consente di

creare volumi e forme sorprendenti.

Questa innovazione dà voce alla “quarta dimensione

del progetto” che è in grado di evocare alberi,

nuvole, aragoste, etc…

I contenitori, posizionabili orizzontalmente e

verticalmente, possono essere composti in modo

infi nito su un’ipotetica griglia (36,8cm x 36,8cm)

che lascia libertà di composizione, tenendo equilibri

formali eccellenti.

Agli ambienti domestici, spesso sovraccarichi di

oggetti dalle elevate prestazioni tecnologiche, LAGO

crede invece nel bisogno di più amore, armonia

e calore. L’innovazione semiotica della “quarta

dimensione”, pur essendo accattivante, garantisce

risposte eccellenti in termini di praticità e funzionalità

senza dimenticare che la funzione primaria rimane

cucinare.

1

The 36e8 cucina project today takes a lighter

approach to perception, overall dimensions and

solidity for kitchen suites; this design approach is

totally revolutionary: our kitchen-non-kitchen suites

break away from rigid outlines and modularity to

create astonishing volumes and forms.

This innovation expresses the “fourth project

dimension” to evoke trees, clouds, lobsters, etc…

Storage units can be positioned horizontally or

vertically and combined in infi nite ways around a

hypothetical grid (36.8cm x 36,8cm) ensuring both

design freedom and excellent formal composition.

Household settings are often over-loaded with

high-tech devices - yet LAGO on the other hand

believes that more love, harmony and warmth are

essential. The semiotic innovation of the “fourth

dimension” is both very attractive and also ensures

excellent responses in practical and functional

terms without forgetting that the primary function is

“cooking”. The 36e8 kitchen suites system develops

around three macro areas: N.O.W bases, wall units

and cupboards.

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Winner of the Good Design Award 2009

Brochure settembre 28.indd 28 7-08-2009 10:33:19

Page 29: Lago News September 2009

29

1

36e8 Cucina: comp. 200

Laccato kaki, prato, bianco,

bosco, salvia e castagno

con top “Laminglass” e ante

in vetro lucido.

Lacquered kaki, prato, bianco,

bosco, salvia and castagno

with “Laminglass” top and

door panels in polished glass.

L. 460 - H. 240,4 - P. 40,6/67

Prezzo a partire da/Price from

€ 9.400 (Elettrodomestici e

dispensa esclusi/ Appliances

and storeroom excluded)

Dispensa N.O.W.

Laccato prato, bosco,

salvia e castagno con ante

in vetro lucido.

N.O.W. Storeroom.

Lacquered prato, bosco,

salvia and castagno with

door panels in polished glass.

L. 294,8 - H. 227 - P. 67

1

2

2

1

Brochure settembre 29.indd 29 7-08-2009 10:34:23

Page 30: Lago News September 2009

36e8 Cucina: comp. 209

Laccato aragosta con top

“Laminglass” e ante in vetro

lucido. Dispensa N.O.W.

Laccato kaki, nero e bianco

con ante in vetro lucido.

Lacquered aragosta with

“Laminglass” top and door

panels in polished glass.

N.O.W. Storeroom.

Lacquered kaki, nero and

bianco with door panels in

polished glass.

L. 441,6 - H. 202 - P. 40,6/67

Prezzo a partire da/Price from

€ 6.410 (Elettrodomestici e

dispensa esclusi/Appliances

and storeroom excluded).

Touch System

Ovviato il problema delle

impronte di farina su pensili

e cassettoni da aprire

eseguendo acrobazie circensi.

È suffi ciente utilizzare testa,

gambe, gomiti, ginocchia

et voilà!

The Touch System helps you

in bad moments. How to open

a wall-cabinet after kneading

pizza? just a masterstroke!

How to pick up the knife from

the drawer while cleaning

the fi sh? You only need a

knee (pay attention to your

kneecap, by the way).

Tecnologia nascosta

Andando un po’

controcorrente, abbiamo

deciso di privilegiare armonia,

calore e forme piuttosto

che proporre un ambiente

sovraccarico di tecnologie.

La soluzione?

Le abbiamo nascoste.

Lavastoviglie, cappa, forno,

frigorifero, congelatore sono

ospitati e protetti all’interno

dei moduli.

Clean design hides

technology. The whole project

aim to lighten the perception

of the ordinary kitchen.

Usually cumbersome and full

of things. We prefer balance,

colour, warmth, clean shapes.

That’s why used all of these

solution to keep technology

in hiding. Fan and dishwasher

are hidden into 36e8 cabinets.

Oven, fridge and freezer are

embraced by the N.O.W.

cupboard instead.

2

3

4

1

4

3

2

Dispensa N.O.W.

Trasferisce in cucina tutti

i plus della zona notte.

Sostituisce la dispensa-

vano elettodomestici con

un vero e proprio armadio

da top di gamma, con

guadagni in termini di

robustezza, risparmio di spazi,

confi gurabilità, semplicità di

forme, qualità delle fi niture e

molteplici opzioni di apertura

dei vani.

Move to the kitchen all the

features from the bedroom.

Plays the role of cupboard

and contains all the

electric devices (apart from

dishwasher), but still keeps

his identity of high quality

wardrobe: is tough as anyone

else, saves more space due to

his special modularity, same

high quality fi nishes of our

successfull wardrobe , clean

design and many different

opening systems.

1

Brochure settembre 30.indd 30 7-08-2009 10:38:14

Page 31: Lago News September 2009

31

36e8 Cucina: comp. 204

Laccato sole e blu oltremare

con top “Laminglass” e ante in

vetro lucido, frigo free-standing.

Lacquered sole and blu oltremare

with “Laminglass” top and

door panels in polished glass,

free-standing refrigerator.

L. 441,6 - H. 195 - P. 40,6/67

Prezzo a partire da/Price from

€ 6.496 (Elettrodomestici

esclusi/Appliances excluded).

36e8 Cucina: comp. 217

Laccato bianco con top

“Laminglass” e ante in

vetro lucido e dispensa.

Lacquered bianco with

“Laminglass” top and

door panels in polished

glass and storeroom.

L. 386,4 - H. 202,4 - P. 40,6/67

Prezzo a partire da/Price from

€ 6.323 (Elettrodomestici

esclusi/Appliances excluded).

36e8 Cucina: comp. 215

Laccato rosso con top e ante

in vetro lucido, dispensa.

Lacquered rosso with top and

door panels in polished glass,

storeroom.

L. 220,8 - H. 93,2 - P. 137

(Isola/Island)

Prezzo a partire da/Price from

€ 14.777 (Elettrodomestici

esclusi/Appliances excluded).

1

2

3

2

3

1

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Brochure settembre 31.indd 31 7-08-2009 10:32:44

Page 32: Lago News September 2009

Leggerezza estrema

Un nuovo trio di prodotti, libreria, tavolo e letto che

inverte l’ordine dei fattori: leggerezza estrema nelle

strutture portanti, in cristallo trasparente e fi sicità

piena del piano e delle mensole. Il risultato è che

mensole, piano del tavolo e letto fl uttuino nell’aria,

quasi fossero sospese nel vuoto.

A new product “trio” - a bookshelf, table and bed

reversing the order of factors: extremely light

load-bearing structures, in transparent crystal glass,

and very solid tops and shelves. The result is that

the shelves, table top and bed seemingly fl oat on air,

almost as if suspended in a vacuum.

AIR

1

2

Letto AIR

Testiera in pelle bianca.

Pianale in HPL sorretto da

un telaio metallico fi ssato

su 4 lastre di vetro Starphire

extrachiaro rettangolari.

AIR Bed

Leather headboard.

HPL platform supported

by a metal frame attached

to 4 extra clear rectangular

Starphire glass plates.

180x200 - H. 29-71 o/or 39-81

Prezzo a partire da (mat. escl.)/

Price from (matt. excl.)

€ 2.340

1

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Letto AIR

Testiera in pelle nero.

Armadio N.O.W. con ante

scorrevoli e fi anchi in vetro

lucido salvia, nero, avio,

fumo, lilla, grafi te. Cassettiere

MORGANA laccato avio e lilla

con frontali in vetro.

Comò 36e8 laccato nero.

AIR bed

Black leather headboard.

N.O.W. wardrobe with sliding

doors and sides in salvia,

nero, avio, fumo, lilla, grafi te

bright glass. MORGANA

chest of drawers, avio and lilla

lacquering with glass fronts.

Black lacquered 36e8 chest

of drawers.

Letto/Bed 180x200

Armadio/Wardrobe N.O.W.

L. 287,3 - H. 265 - P. 66,7

MORGANA

L. 60 - H. 54 - P. 45,3

Comò/Chest of drawers

L. 147,2 - H. 552 - P. 40,6

2

Brochure settembre 32.indd 32 7-08-2009 10:17:25

Page 33: Lago News September 2009

33

4

3

5

AIR: comp. 80

Laccato bianco.

Bianco lacquering.

L. 522,8 - H. 239,7 - P. 441,6

AIR: comp. 75

Laccato bianco.

Set vetri porta DVD.

Bianco lacquering.

Glass set, DVD player holder.

L. 310,4 - H. 249,7 - P. 40,6

Prezzo a partire da/Price from

€ 3.312

Tavolo AIR

Rovere grigio HP.

AIR Table

HP Grey oak.

L. 250 - P. 100 - H. 76

Prezzo a partire da/Price from

€ 1.953

3

4

5

Brochure settembre 33.indd 33 7-08-2009 10:20:59

Page 34: Lago News September 2009

Una “rete” di cubi

Un cubo, due cubi, una “rete” di cubi da 40

centimetri per lato si incontrano e si combinano

offrendo ad ognuno l’opportunità di creare una

libreria a propria immagine e somiglianza.

NET allarga i confi ni della creatività, e non teme

i limiti spaziali adattandosi con facilità alle situazioni,

dividendo aree e creandone di nuove.

Uno dei suoi punti di forza è il perno di congiunzione

verticale tra un cubo e l’altro: questo consente

la rotazione di ogni singolo elemento.

E così, una composizione lineare e ordinata

può diventare sinuosa e dinamica.

A single cube, two cubes, a “network” of cubes

measuring 40 centimetres per side mix and match

to offer everyone the chance to create bookshelves

with a truly personal touch.

NET expands the boundaries of creativity by

overcoming spatial limitations and easily adapting

to different situations to share existing and create

new spaces. One of its selling points is the vertical

pin between each of the cubes: this means that

every single element can be rotated.

Which in turn means that linear and orderly

composition can become sinuous and dynamic.

NET

1

NET: comp. 52

Laccato bianco.

Bianco lacquering.

L. 527 - H. 281 - P. 299

1 cubo laccato bianco prezzo

a partire da/1 single cube,

bianco lacquering price from

€ 290

1

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Brochure settembre 34.indd 34 7-08-2009 10:36:09

Page 35: Lago News September 2009

35

Kids bedrooms

Gli stessi “ingredienti” che hanno caratterizzato

gli altri ambienti della casa, ovvero i prodotti LAGO,

si amalgamano creando ambientazioni più fresche,

più vivaci e vicine a quella fase della vita in cui tutto

è gioco. La giovinezza. Una fase in cui è ancora lecito

“volare” con la fantasia: è così che l’armadio di un

bambino diventa un grande pesce rosso. È così che

un serpente si insinua nella stanza. È così che una

fi ammante Ferrari si materializza sulla parete.

Un design a misura di bambino e non a misura

d’uomo: ecco la nuova ricetta.

The same “ingredients” characterising LAGO’s

renowned products for other home settings now

blend to create even fresher and livelier atmospheres

for the time of life when everything is playtime. Kids!

An age where “fl ights of fantasy” are so important:

which is why our wardrobe for kids resembles a

huge goldfi sh. Or a snake swirling into the bedroom.

Or a bright red Ferrari materialising on the wall.

Design for kids - not for adults:

this is the new approach.

2

1

1

2

Letto FLUTTUA

Letto singolo con testiera

in ecopelle col. 608 e

illuminazione sottorete.

Armadio N.O.W. con ante

scorrevoli e fi anchi in vetro

lucido nero, sole, rosso e

bianco. Tangram laccato

rosso e sole.

FLUTTUA Bed

Single bed with headrest

ecological leather col. E608

and underframe lighting.

N.O.W. wardrobe with sliding

doors and sides made of

polished glass in the colours

nero, sole, rosso and bianco.

Tangram rosso and sole

lacquered.

Letto/Bed 100x205

Armadio/Wardrobe N.O.W.

L. 187,3 - H. 265 - P. 66,7

Tangram rosso

L. 171 - H. 182 - P. 24

Tangram sole

L. 108 - H. 199 - P. 24

Prezzo a partire da (materasso

escluso)/ Price from (mattress

excluded)

€ 6.918

Letto JUSTMAT. Libreria 36e8

laccato bianco e nero.

30mm con struttura laccato

bianco e nero. Altalena

SOFT-SWING laccato bianco.

JUSTMAT bed. 36e8

bookcase, bianco and nero

lacquering. 30mm with bianco

and nero lacquered structure.

SOFT-SWING, white

lacquering.

Altalena/Soft-Swing

L. 56,1 - P. 28,1 - Sp.6

Letto/Bed 240x160

Libreria/Bookcase 36e8

L. 257,6 - H. 128,8 - P. 40,6

30mm

L. 162,2 - H. 220,8 - P. 38,4

Prezzo a partire da (materasso

escluso)/Price from (mattress

excluded)

€ 6.277

Brochure settembre 35.indd 35 7-08-2009 10:37:03

Page 36: Lago News September 2009

JUSTMAT

1 materasso + 4 ruote = 1 letto. È questa

l’elementare addizione che sta alla base del progetto

JUSTMAT. Una soluzione semplice e funzionale che

ha come protagonista un materasso che si allunga,

si incurva e diventa, così, una testiera.

Le ruote che sostituiscono i piedini rendono il letto

facilmente trasportabile e dinamico.

1 mattress + 4 wheels = 1 bed. This is the

elementary addition underlying the JUSTMAT

project. A simple and functional solution focusing

on a mattress that can be elongated and shaped

to become a bed-head. The wheels in place of feet

make this bed easy to move and dynamic.

Letto JUSTMAT

JUSTMAT Bed

160x240

Prezzo a partire da (materasso

escluso)/Price from (mattress

excluded)

€ 2.090

Letto JUSTMAT con testiera

col. righe. Armadio N.O.W.

(comp. 122) con ante battenti

e fi anchi in vetro lucido prato,

rosso, verde acido, kaki, lilla,

bosco e in vetro opaco bianco

e nero. Cassettiere MORGANA

con ruote, in vetro lucido

bianco.

JUSTMAT bed with headrest

col. striped. N.O.W. wardrobe

(comp. 122) with conventional

doors and polished glass

sides in the colours prato,

rosso, verde acido, kaki, lilla,

bosco and opaque glass in

the colours bianco and nero.

MORGANA bianco polished

glass chest of drawers with

wheels.

Letto/Bed 160x240

Armadio/Wardrobe

L 369,5 - H 265 - P 60,9

Comodini e cassettiera

MORGANA/Chest of drawers

and Bedside table MORGANA

L 60 - H 48,3/138,3 - P 45,3

1

2

1

2

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Brochure settembre 36.indd 36 7-08-2009 10:29:04

Page 37: Lago News September 2009

37

STEPSDesign Monica Graffeo

Una sedia e un letto dall’aspetto materico.

Il rigore e la pulizia formale, insieme alla

componente ludica di questi due prodotti,

defi niscono il loro carattere.

Per assemblare sedia e letto è suffi ciente far calzare

sulla rispettiva struttura in alluminio le corrispondenti

fette di feltro che, nel caso del letto, possono essere

anche allontanate rendendolo personalizzabile.

A solid chair and bed with a lightweight appearance.

Formal rigour and purity, together with the

delightful design of these two products, ensure

strong character.

The chair and bed are easy to assemble - simply fi t

the felt pads on the respective aluminium structure.

These “pads”, for the bed, can also be positioned at

a distance for maximum “customisation”.

STEPS_B con struttura in

alluminio e seduta, schienale e

testata in feltro grigio.

STEPS_B with aluminum

structure and grey felt sit, back

and headboard.

Letto/Bed L. 165 - H. 86,7 - P. 224

Prezzo a partire da (materasso

escluso)/Price from (mattress

excluded)

€ 2.150

STEPS_C con struttura in

alluminio e seduta, schienale

e testata in feltro grigio.

STEPS_C with aluminum

structure and grey felt sit,

back and headboard.

L. 45 - H. 77 - P. 51

Prezzo a partire da/Price from

€ 230

1

2 1

2

Brochure settembre 37.indd 37 7-08-2009 10:45:39

Page 38: Lago News September 2009

FLUTTUAFLUTTUA è un letto sospeso, regolabile in altezza

e disponibile nelle forme rotonda e rettangolare.

FLUTTUA è il letto dal quale abbiamo tolto il

superfl uo lasciando spazio al pensiero.

La caratteristica del prodotto è quella di avere solo

una gamba centrale e di essere composto da un

pianale di spessore 8 mm abbinato a una solida

struttura in ferro da fi ssare alla parete.

FLUTTUA is a suspended, height-adjustable bed

available in round and rectangular models.

The FLUTTUA bed eliminates everything superfl uous

to leave more room for thought.

The characteristic of the product is its single,

height-adjustable central leg and 8 mm thick layer

base combined with a solid iron structure anchored

to the wall.

1

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Brochure settembre 38.indd 38 7-08-2009 10:31:07

Page 39: Lago News September 2009

39

Letto FLUTTUA R con testiera

in pelle bianca e illuminazione

sottorete. Armadio N.O.W.

con ante battenti e fi anchi

in vetro lucido bianco.

Comò 36e8 laccato bianco

con specchio argentato.

Comodini 36e8 laccato

bianco.

FLUTTUA R bed with white

leather headboard and under

slat lighting. N.O.W. wardrobe

with hinged doors and sides in

white matt glass. 36e8 chest

of drawers, white lacquering

with silver mirror.

36e8 bedside tables, white

lacquering.

Letto/Bed

L. 180 - P. 205 - H. 48/63

Armadio/ Wardrobe

L. 316,5 - H. 265 - P. 60,9

Comò/Chest of drawers

L. 147,2 - H. 55,2 - P. 40,6

Comodini/Bedside tables

L. 73,6 - H. 18,4/36,8 - P. 40,6

Specchio/Mirror

L. 147,2 - H. 73,6 - P. 2

Prezzo a partire da (materasso

escluso)/Price from (mattress

excluded)

€ 9.057

1

Brochure settembre 39.indd 39 7-08-2009 10:18:47

Page 40: Lago News September 2009

NOT ONLY WHITE

An inifi nitely customisable wardrobe.

A hideaway cabinet-wardrobe that integrates

perfectly with home architecture hidden between

the walls. Innovative colour and a fl exible and

versatile system that meets everyone’s needs.

Not just a simple modular system but a product

that combines the fi nal object with dreams.

The modular bands (21-115 cm with many

intermediate widths) create the design of this

wardrobe-cabinet by defi ning a new visual rhythm;

moreover, the innovative door opening system

eliminates handles to blend N.O.W. with the

architecture of the wall or by creating new colour

moods in harmony with adjacent settings.

The result is a truly made-to-measure solution in

terms of dimensions and also sensations: every

band in short can have a different colour.

L’armadio personalizzabile all’infi nito

L’armadio che scompare e si integra perfettamente

con l’architettura della casa nascondendosi tra

le pareti. Con un uso del colore innovativo e un

sistema così fl essibile e versatile da essere a misura

di desiderio di ciascuno. Non un semplice sistema

componibile, ma un prodotto che fa coincidere il

sogno pensato con l’oggetto realizzato.

Le fasce modulari, da 21 a 115cm con molteplici

larghezze intermedie, creano il design dell’armadio

dando un nuovo ritmo visivo e, inoltre, l’innovativo

sistema di apertura delle ante cancella le maniglie

mimetizzando N.O.W. con l’architettura della parete,

oppure creando nuovi mood cromatici in armonia

con gli ambienti circostanti.

Nasce così una soluzione realmente al centimetro,

per le dimensioni ma anche per le sensazioni: ogni

fascia può assumere infatti un colore differente.

1

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Brochure settembre 40.indd 40 7-08-2009 10:48:13

Page 41: Lago News September 2009

41

N.O.W.: comp. 101

Ante battenti e fi anchi

in vetro opaco bianco ed in

vetro lucido cocco e panna.

Hinged doors and sides

in bianco coloured matt

glass and cocco and panna

coloured bright glass.

L. 401,5 - H. 265 - P. 60,9

Prezzo a partire da/Price from

€ 5.240

Con la semplice pressione

della mano si crea una

depressione che permette di

aprire l’anta.

A new type of opening: the

door can be opened with a

simple push.

N.O.W.: comp. 105

Ante battenti e fi anchi in vetro

opaco bianco.

Hinged doors and sides in

bianco coloured matt glass.

L. 510,5 - H. 265 - P. 60,9

Prezzo a partire da/Price from

€ 6.690

N.O.W.: comp. 106

Ante battenti e fi anchi in vetro

opaco bianco, sole e prato,

in vetro lucido nero e blu

oltremare. Anta scorrevole

in vetro lucido rosso.

Hinged doors and sides

in bianco, sole and prato

coloured matt glass and nero

and blu oltremare coloured

bright glass. Sliding door in

rosso coloured bright glass.

L. 302,5 - H. 243 - P. 66,7

Prezzo a partire da/Price from

€ 4.150

2

3

4

1

2

3

4

Brochure settembre 41.indd 41 7-08-2009 11:02:46

Page 42: Lago News September 2009

Un materasso avvolto come la cialda di un cono

gelato infi lato dentro una piccola base cilindrica

in legno. Questa è l’accogliente e pratica poltrona

HUGGY. La presa dell’anello di base stringe la

parte inferiore del materasso tenendolo unito

e creando una avvolgente seduta con morbidi

braccioli. Sfi lando la base, il materasso si srotola

automaticamente e diventa all’occorrenza un

comodo letto d’emergenza per ospiti; la base si

capovolge e diventa un utile comodino.

A mattress wrapped like the wafer of an ice-cream

cone inserted inside a small cylindrical wooden base.

This is the inviting and practical HUGGY armchair.

The hold of the base ring grips the lower part of

the mattress, holding it together and creating a

wrap-around seat with soft arms. By unscrewing

the base, the mattress is automatically unrolled and

when required becomes a comfortable emergency

bed for guests; when the base is turned upside-down

it becomes a useful night table.

Poltroncina HUGGY

HUGGY Armchair

Poltrona/Armchair

130x78x64

Materasso/Mattress

175x85

Base-comodino/Base-nigh table

D. 64 - H. 35 - Sp. 12

Prezzo a partire da/Price from

€ 910

1

1

HUGGYDesign Brit Leissler/Lagostudio

Tutti i prezzi indicati si intendono escluso progettazione, trasporto e montaggio. All given prices exclude design, transport and assemblage.

Brochure settembre 42.indd 42 7-08-2009 11:01:52

Page 43: Lago News September 2009

43

1

Brochure settembre 43.indd 43 7-08-2009 11:00:57

Page 44: Lago News September 2009

Carlo Dalcielo EN PLEIN AIRA cura di Bruno Lorini e Giulio Mozzi

Un progetto speciale che, attraverso un intervento semplice e

silenzioso come quello della pittura ad olio, crea una serie di

situazioni e relazioni coinvolgendo non solo il pittore e la sua tela, ma

anche l’ambiente e le persone, facendoli diventare parte integrante

dell’azione. L’azienda è vista come un paesaggio ed il pittore con la

sua tela provoca il nostro sguardo, lo amplifica - o lo filtra - ci invita -

o ci costringe – ad usare i nostri occhi in modi inaspettati.

A special, unique project that sets up diverse atmospheres simply

through silent oil painting. Painting involves not only the painter

with his canvas, but also the surrounding environment and people

who become a whole with the action itself. The company is ideally

conceived as the landscape and the painter with his canvas captures

our looks. He invites us and forces us to watch through different eyes.

ART WAITING ROOM

6 Luglio 2009 - 25 Settembre 2009

Lun/Ven 8.30-12 e 14.30-18 Sab e Dom chiuso.

L’Art Waiting Room è il modo in cui LAGO

ha interpretato la propria sala d’attesa.

Progetto in collaborazione con: Fondazione March

LAGO S.p.A

Via dell’Artigianato ll n.21

35010 Villa del Conte, Padova, Italia

T +39.049.599.4299 F +39.049.599.4191

www.lago.it

[email protected]

Brochure settembre 44.indd 44 7-08-2009 11:01:33


Top Related